shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(KIAA0513-shRNA-Seq1)(CAT#: AdV-SI0744WQ)
This product is a KIAA0513-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. KIAA0513, a novel signaling molecule that interacts with modulators of neuroplasticity, apoptosis, and the cytoskeleton. The expression of KIAA0513-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | KIAA0513-shRNA-Seq1 |
Related Target/Protein | KIAA0513 |
Region | CDS |
TargetSeq | CAAGAAGCTGTGCAATGACTT |
NCBI RefSeq | NM_014732 |
Titer | >1*10^10 GC/mL |
Related Diseases | Pancreatic carcinoma |