shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(KIAA0930-shRNA-Seq2)(CAT#: AdV-SI0977WQ)

This product is a KIAA0930-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of KIAA0930-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert KIAA0930-shRNA-Seq2
Related Target/Protein KIAA0930
Region CDS
TargetSeq CCTGAATCTCATCCTGCAGAA
NCBI RefSeq NM_015264
Alternative Names LSC3; C22orf9
Titer >1*10^10 GC/mL
Related Diseases Melanoma
Target Gene
Gene ID 23313
Uniprot ID Q6ICG6

Related Products