shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LGI4-shRNA-Seq1)(CAT#: AdV-SI0592WQ)
This product is a LGI4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The LGI4 gene encoded protein is component of Schwann cell signaling pathway(s) that controls axon segregation and myelin formation (By similarity). The expression of LGI4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | LGI4-shRNA-Seq1 |
Related Target/Protein | LGI4 |
Region | CDS |
TargetSeq | CAACTCCTTCTCCGTGATTGA |
NCBI RefSeq | NM_139284 |
Alternative Names | LGIL3; AMCNMY |
Titer | >1*10^10 GC/mL |
Related Diseases | Neurological diseases |