shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LOC441799-shRNA-Seq3)(CAT#: AdV-SI2424WQ)

Datasheet

This product is a LOC441799-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of LOC441799-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert LOC441799-shRNA-Seq3
Related Target/Protein LOC441799
Region CDS
TargetSeq GTTGTGGAAAGTAAACAGAAA
NCBI RefSeq XM_497554
Titer >1*10^10 GC/mL

Related Products

Recombinant adenovirus, pU6-(Mouse Gjc1), Overexpression (CAT#:AdV-GTOH0514WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Olfr750-shRNA-Seq5) (CAT#:AdV-SI3759WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR5M11-shRNA-Seq5) (CAT#:AdV-SI1571WQ) Recombinant adenovirus, pU6-(Human hBD3), Overexpression (CAT#:AdV-GTOH0791WQ) Recombinant adenovirus, pU6-(Human E2F1), Overexpression (CAT#:AdV-GTOH0087WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Eif2b1-shRNA-Seq5) (CAT#:AdV-SI3615WQ) Recombinant adenovirus, pU6-(Human NPC1L1), Overexpression (CAT#:AdV-GTOH0741WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(FAM129C-shRNA-Seq1) (CAT#:AdV-SI0427WQ)