shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LRRC47-shRNA-Seq1)(CAT#: AdV-SI0946WQ)

This product is a LRRC47-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The LRRC47 gene encodes a protein that significantly changed phosphorylation state in response to short-term vasopressin treatment. The expression of LRRC47-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LRRC47-shRNA-Seq1
Related Target/Protein LRRC47
Region CDS
TargetSeq GTGATTTCCTTCCCACCAATA
NCBI RefSeq NM_020710
Titer >1*10^10 GC/mL
Related Diseases Short-term vasopressin
Target Gene
Gene ID 57470
Uniprot ID Q8N1G4

Related Products