shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LRRC49-shRNA-Seq2)(CAT#: AdV-SI0822WQ)

This product is a LRRC49-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of LRRC49-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LRRC49-shRNA-Seq2
Related Target/Protein LRRC49
Region CDS
TargetSeq GCTCAAGAGTCATGGTACAAA
NCBI RefSeq NM_017691
Alternative Names PGs4
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 54839
Uniprot ID Q8IUZ0

Related Products