shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LSM14B-shRNA-Seq3)(CAT#: AdV-SI0922WQ)

This product is a LSM14B-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The LSM14B gene may play a role in control of mRNA translation. The expression of LSM14B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LSM14B-shRNA-Seq3
Related Target/Protein LSM14B
Region CDS
TargetSeq GAGGAGCTTGACAAAGAATTT
NCBI RefSeq NM_144703
Alternative Names FT005; LSM13; FAM61B; RAP55B; C20orf40; bA11M20.3
Expression
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 149986
Uniprot ID Q9BX40

Related Products