shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Med18-shRNA-Seq5)(CAT#: AdV-SI2732WQ)
This product is a Med18-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Med18 gene is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II. The expression of Med18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Med18-shRNA-Seq5 |
| Related Target/Protein | Med18 |
| Region | 3UTR |
| TargetSeq | GAATTAAAGGCGTGCGATAAC |
| NCBI RefSeq | NM_026039 |
| Alternative Names | SRB5; p28b |
| Titer | >1*10^10 GC/mL |
