shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Prb1-shRNA-Seq1)(CAT#: AdV-SI3164WQ)
This product is a Prb1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Prb1 gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. The expression of Prb1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Prb1-shRNA-Seq1 |
Related Target/Protein | Prb1 |
Region | CDS |
TargetSeq | CGAAGACTCAAATTCTCAGCT |
NCBI RefSeq | NM_198669 |
Alternative Names | PM; PMF; PMS; PRB1L; PRB1M |
Titer | >1*10^10 GC/mL |