shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(MUM1L1-shRNA-Seq1)(CAT#: AdV-SI0955WQ)

This product is a MUM1L1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The MUM1L1 gene encodes a protein which contains a mutated melanoma-associated antigen 1 domain. The expression of MUM1L1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert MUM1L1-shRNA-Seq1
Related Target/Protein MUM1L1
Region CDS
TargetSeq CACATCCGTTTGAAACAGGAA
NCBI RefSeq NM_152423
Alternative Names MUM1L1
Titer >1*10^10 GC/mL
Related Diseases Endometrial carcinoma
Target Gene
Gene ID 139221
Uniprot ID Q5H9M0

Related Products