shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(N4bp2l2-shRNA-Seq6)(CAT#: AdV-SI2771WQ)
This product is a N4bp2l2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The N4bp2l2 gene has enzyme binding and transcription corepressor activity. The expression of N4bp2l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | N4bp2l2-shRNA-Seq6 |
Related Target/Protein | N4bp2l2 |
Region | 3UTR |
TargetSeq | GTAATCCACTGACAACATATA |
NCBI RefSeq | NM_201369 |
Alternative Names | CG005; CG016; PFAAP5; 92M18.3 |
Titer | >1*10^10 GC/mL |