shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Nkd1-shRNA-Seq1)(CAT#: AdV-SI3183WQ)

This product is a Nkd1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Nkd1 gene may activate a second Wnt signaling pathway that controls planar cell polarity. The expression of Nkd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Nkd1-shRNA-Seq1
Related Target/Protein Nkd1
Region CDS
TargetSeq CACCATTACCACCACTTCTAT
NCBI RefSeq NM_027280
Alternative Names Naked1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 85407
Uniprot ID Q969G9

Related Products