shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(RTBDN-shRNA-Seq2)(CAT#: AdV-SI0875WQ)

This product is a RTBDN-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by RTBDN gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. The expression of RTBDN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert RTBDN-shRNA-Seq2
Related Target/Protein RTBDN
Region CDS
TargetSeq GAATGCGAATCCTTCCTGGAA
NCBI RefSeq NM_031429
Titer >1*10^10 GC/mL
Related Diseases Eye disease
Target Gene
Gene ID 83546
Uniprot ID Q9BSG5

Related Products