shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Rtn4ip1-shRNA-Seq1)(CAT#: AdV-SI3102WQ)

This product is a Rtn4ip1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Rtn4ip1 gene encodes a mitochondrial protein that interacts with reticulon 4, which is a potent inhibitor of regeneration following spinal cord injury. The expression of Rtn4ip1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Rtn4ip1-shRNA-Seq1
Related Target/Protein Rtn4ip1
Region CDS
TargetSeq GAACATGATGTTACCTATCAT
NCBI RefSeq NM_130892
Alternative Names NIMP; OPA10
Titer >1*10^10 GC/mL
Related Diseases Optic atrophy
Target Gene
Gene ID 84816
Uniprot ID Q8WWV3

Related Products