shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Rtn4ip1-shRNA-Seq1)(CAT#: AdV-SI3102WQ)
This product is a Rtn4ip1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Rtn4ip1 gene encodes a mitochondrial protein that interacts with reticulon 4, which is a potent inhibitor of regeneration following spinal cord injury. The expression of Rtn4ip1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Rtn4ip1-shRNA-Seq1 |
Related Target/Protein | Rtn4ip1 |
Region | CDS |
TargetSeq | GAACATGATGTTACCTATCAT |
NCBI RefSeq | NM_130892 |
Alternative Names | NIMP; OPA10 |
Titer | >1*10^10 GC/mL |
Related Diseases | Optic atrophy |