shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SF3A3-shRNA-Seq4)(CAT#: AdV-SI0558WQ)
This product is a SF3A3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SF3A3 gene encodes subunit 3 of the splicing factor 3a protein complex, which interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. The expression of SF3A3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | SF3A3-shRNA-Seq4 |
Related Target/Protein | SF3A3 |
Region | CDS |
TargetSeq | CTGAGGGATTTGTATGATGAT |
NCBI RefSeq | NM_006802 |
Alternative Names | PRP9; PRPF9; SAP61; SF3a60 |
Titer | >1*10^10 GC/mL |
Related Diseases | Lung cancer |