shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SH3D19-shRNA-Seq2)(CAT#: AdV-SI0778WQ)
This product is a SH3D19-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SH3D19 gene encoded protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. The expression of SH3D19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | SH3D19-shRNA-Seq2 |
Related Target/Protein | SH3D19 |
Region | 3UTR |
TargetSeq | GCCAAATAGGTTGAAGACAAT |
NCBI RefSeq | NM_001009555 |
Alternative Names | EBP; EVE1; Kryn; Eve-1; SH3P19 |
Titer | >1*10^10 GC/mL |
Related Diseases | Acute myeloid leukemia |