shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(WDR74-shRNA-Seq1)(CAT#: AdV-SI0952WQ)

This product is a WDR74-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The WDR74 gene participates in an early cleavage of the pre-rRNA processing pathway in cooperation with NVL and is required for blastocyst formation, is necessary for RNA transcription, processing and/or stability during preimplantation development. The expression of WDR74-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert WDR74-shRNA-Seq1
Related Target/Protein WDR74
Region CDS
TargetSeq CTAGAAGACACAGAGACAGAT
NCBI RefSeq NM_018093
Alternative Names Nsa1
Titer >1*10^10 GC/mL
Related Diseases Mammary adenocarcinoma
Target Gene
Gene ID 54663
Uniprot ID Q6RFH5

Related Products