shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(XIRP1-shRNA-Seq1)(CAT#: AdV-SI2413WQ)
This product is a XIRP1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by XIRP1 gene is a striated muscle protein and belongs to the Xin actin-binding repeat-containing protein (XIRP) family. The protein functions to protect actin filaments during depolymerization. The expression of XIRP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | XIRP1-shRNA-Seq1 |
| Related Target/Protein | XIRP1 |
| Region | CDS |
| TargetSeq | GAGTCAAGTCAAGATCAGAAA |
| NCBI RefSeq | NM_194293 |
| Alternative Names | Xin; CMYA1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cardiovascular disease |
