shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(XIRP1-shRNA-Seq1)(CAT#: AdV-SI2413WQ)

This product is a XIRP1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by XIRP1 gene is a striated muscle protein and belongs to the Xin actin-binding repeat-containing protein (XIRP) family. The protein functions to protect actin filaments during depolymerization. The expression of XIRP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert XIRP1-shRNA-Seq1
Related Target/Protein XIRP1
Region CDS
TargetSeq GAGTCAAGTCAAGATCAGAAA
NCBI RefSeq NM_194293
Alternative Names Xin; CMYA1
Titer >1*10^10 GC/mL
Related Diseases Cardiovascular disease
Target Gene
Gene ID 165904
Uniprot ID Q702N8

Related Products