shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(PRR14-shRNA-Seq2)(CAT#: AdV-SI0433WQ)

This product is a PRR14-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PRR14 gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The expression of PRR14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PRR14-shRNA-Seq2
Related Target/Protein PRR14
Region CDS
TargetSeq CTCCTGGAGGAAGAAACAGTA
NCBI RefSeq NM_024031
Titer >1*10^10 GC/mL
Related Diseases Lung cancer
Target Gene
Gene ID 78994
Uniprot ID Q9BWN1

Related Products