shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Zpbp-shRNA-Seq4)(CAT#: AdV-SI2809WQ)

This product is a Zpbp-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. ZPBP is one of several proteins that are thought to participate in secondary binding between acrosome-reacted sperm and the egg-specific extracellular matrix, the zona pellucida. The expression of Zpbp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Zpbp-shRNA-Seq4
Related Target/Protein Zpbp
Region CDS
TargetSeq CCTGTGAAATATCCTTGATTA
NCBI RefSeq NM_015785
Alternative Names ZPBP1
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 11055
Uniprot ID Q9BS86

Related Products