shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(2310044H10Rik-shRNA-Seq2)(CAT#: AdV-SI1948WQ)

This product is a 2310044H10Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 2310044H10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 2310044H10Rik-shRNA-Seq2
Related Target/Protein 2310044H10Rik
Region CDS
TargetSeq GAAGTCTTTCTTTGCCAAATA
NCBI RefSeq NM_197991
Alternative Names Inm02; Mirta22; Emc10; 5430410O10Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 69683
Uniprot ID A0A0X1KG67

Related Products