shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(4930447C04Rik-shRNA-Seq3)(CAT#: AdV-SI1864WQ)
This product is a 4930447C04Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 4930447C04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | 4930447C04Rik-shRNA-Seq3 |
Related Target/Protein | 4930447C04Rik |
Region | CDS |
TargetSeq | GGACATTATACGTAGTTAATT |
NCBI RefSeq | NM_029444 |
Alternative Names | Six6OS; Six6as; Six6os1; 4921504I02Rik; A930035O15Rik |
Titer | >1*10^10 GC/mL |