shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(LRRN4-shRNA-Seq3)(CAT#: AdV-SI1615WQ)

This product is a LRRN4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The LRRN4 gene may play an important role in hippocampus-dependent long-lasting memory. The expression of LRRN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert LRRN4-shRNA-Seq3
Related Target/Protein LRRN4
Region CDS
TargetSeq GATGCAAAGAGAACTGTCCTA
NCBI RefSeq NM_152611
Alternative Names NLRR4; NLRR-4; C20orf75; dJ1056H1.1
Titer >1*10^10 GC/mL
Related Diseases Nervous system disease
Target Gene
Gene ID 164312
Uniprot ID Q8WUT4

Related Products