shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(C4orf41-shRNA-Seq2)(CAT#: AdV-SI0242WQ)

This product is a C4orf41-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by C4orf41 gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. The expression of C4orf41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C4orf41-shRNA-Seq2
Related Target/Protein C4orf41
Region 3UTR
TargetSeq CATGAAAGAATGTCAGACCAT
NCBI RefSeq NM_021942
Alternative Names GRY; FOIGR; LGMD2S; TRAPPC11; LGMDR18
Titer >1*10^10 GC/mL
Target Gene
Gene ID 60684
Uniprot ID Q7Z392

Related Products