shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(D730001G18Rik-shRNA-Seq1)(CAT#: AdV-SI2349WQ)

This product is a D730001G18Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by D730001G18Rik has acetylcholine receptor inhibitor activity. The expression of D730001G18Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert D730001G18Rik-shRNA-Seq1
Related Target/Protein D730001G18Rik
Region CDS
TargetSeq CCTCTATGAGACCTTCAGAGT
NCBI RefSeq NM_172433
Alternative Names Ly6g6g
Titer >1*10^10 GC/mL
Target Gene
Gene ID 78725
Uniprot ID A0A087WQU7

Related Products