shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(DPY19L4-shRNA-Seq3)(CAT#: AdV-SI2190WQ)

This product is a DPY19L4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by DPY19L4 gene is probable C-mannosyltransferase that mediates C-mannosylation of tryptophan residues on target proteins. The expression of DPY19L4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert DPY19L4-shRNA-Seq3
Related Target/Protein DPY19L4
Region CDS
TargetSeq CCCGAACTTTGGATGACACTT
NCBI RefSeq NM_181787
Titer >1*10^10 GC/mL
Target Gene
Gene ID 286148
Uniprot ID Q7Z388

Related Products