shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(EFCAB4A-shRNA-Seq1)(CAT#: AdV-SI0389WQ)
This product is a EFCAB4A-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The EFCAB4A gene plays a role in store-operated Ca2+ entry (SOCE). The expression of EFCAB4A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | EFCAB4A-shRNA-Seq1 |
| Related Target/Protein | EFCAB4A |
| Region | CDS |
| TargetSeq | GCTGTTTCTGCTGTGTGACAA |
| NCBI RefSeq | NM_173584 |
| Alternative Names | CRACR2B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Chronic bronchitis |
