shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Gsdmd-shRNA-Seq1)(CAT#: AdV-SI2316WQ)

This product is a Gsdmd-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Gsdmd gene is a member of the gasdermin family and play a role in regulation of epithelial proliferation. The expression of Gsdmd-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Gsdmd-shRNA-Seq1
Related Target/Protein Gsdmd
Region CDS
TargetSeq CTGGTGAACATCGGAAAGATT
NCBI RefSeq NM_026960
Alternative Names DF5L; DFNA5L; FKSG10; GSDMDC1
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 79792
Uniprot ID P57764

Related Products