shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(KCTD2-shRNA-Seq2)(CAT#: AdV-SI0417WQ)

This product is a KCTD2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. KCTD2, an adaptor of Cullin3 E3 ubiquitin ligase, suppresses gliomagenesis by destabilizing c-Myc. The expression of KCTD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert KCTD2-shRNA-Seq2
Related Target/Protein KCTD2
Region CDS
TargetSeq GCTGGAAATTCGAACAGCTCA
NCBI RefSeq NM_015353
Titer >1*10^10 GC/mL
Related Diseases Ischaemic Stroke and Alzheimer's Disease
Target Gene
Gene ID 23510
Uniprot ID Q14681

Related Products