shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Phf14-shRNA-Seq1)(CAT#: AdV-SI2234WQ)

This product is a Phf14-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Phf14 gene has metal ion binding ability. The expression of Phf14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Phf14-shRNA-Seq1
Related Target/Protein Phf14
Region 3UTR
TargetSeq CTCCTCAAGCTTCAAAGACTT
NCBI RefSeq NM_029404
Titer >1*10^10 GC/mL
Target Gene
Gene ID 9678
Uniprot ID O94880

Related Products