shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Sash3-shRNA-Seq1)(CAT#: AdV-SI2246WQ)

This product is a Sash3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Sash3 gene contains a Src homology-3 (SH3) domain and a sterile alpha motif (SAM), both of which are found in proteins involved in cell signaling. This protein may function as a signaling adapter protein in lymphocytes. The expression of Sash3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Sash3-shRNA-Seq1
Related Target/Protein Sash3
Region 3UTR
TargetSeq CCACTATCCTTCTCAACATTT
NCBI RefSeq NM_028773
Alternative Names SLY; 753P9; HACS2; CXorf9; SH3D6C
Titer >1*10^10 GC/mL
Related Diseases Lymphoma
Target Gene
Gene ID 54440
Uniprot ID O75995

Related Products