shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SELRC1-shRNA-Seq3)(CAT#: AdV-SI0307WQ)
This product is a SELRC1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SELRC1 gene is required for assembly of mitochondrial respiratory chain complex I and complex IV. The expression of SELRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SELRC1-shRNA-Seq3 |
| Related Target/Protein | SELRC1 |
| Region | 3UTR |
| TargetSeq | GCCATCGTCTAGAAGAGACAT |
| NCBI RefSeq | NM_023077 |
| Alternative Names | RESA1; SCAN3; COA7; C1orf163 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Respiratory disease |
