shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SPIRE2-shRNA-Seq2)(CAT#: AdV-SI0262WQ)
This product is a SPIRE2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SPIRE2 acts as an actin nucleation factor, remains associated with the slow-growing pointed end of the new filament and is involved in intracellular vesicle transport along actin fibers, providing a novel link between actin cytoskeleton dynamics and intracellular transport. The expression of SPIRE2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | SPIRE2-shRNA-Seq2 |
Related Target/Protein | SPIRE2 |
Region | 3UTR |
TargetSeq | CATGATGAAATGTTGTCTCTA |
NCBI RefSeq | NM_032451 |
Alternative Names | Spir-2 |
Titer | >1*10^10 GC/mL |