shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Tmem26-shRNA-Seq1)(CAT#: AdV-SI2212WQ)

This product is a Tmem26-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Tmem26 gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. The expression of Tmem26-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Tmem26-shRNA-Seq1
Related Target/Protein Tmem26
Region CDS
TargetSeq CAGAGGCTTTGTCGACAATTT
NCBI RefSeq NM_177794
Titer >1*10^10 GC/mL
Target Gene
Gene ID 219623
Uniprot ID Q6ZUK4

Related Products