shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Vmn1r85-shRNA-Seq2)(CAT#: AdV-SI1990WQ)
This product is a Vmn1r85-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Vmn1r85 gene has pheromone binding and pheromone receptor activity. The expression of Vmn1r85-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Vmn1r85-shRNA-Seq2 |
Related Target/Protein | Vmn1r85 |
Region | CDS |
TargetSeq | GTTCATCAACATGGTCATATA |
NCBI RefSeq | NM_145847 |
Alternative Names | V1rj3 |
Titer | >1*10^10 GC/mL |