shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(ZNF714-shRNA-Seq2)(CAT#: AdV-SI0349WQ)

This product is a ZNF714-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The ZNF714 gene may be involved in transcriptional regulation. The expression of ZNF714-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert ZNF714-shRNA-Seq2
Related Target/Protein ZNF714
Region 3UTR
TargetSeq CCCTCAATTCTTAACAGACAT
NCBI RefSeq NM_182515
Titer >1*10^10 GC/mL
Related Diseases Type 1 diabetes
Target Gene
Gene ID 148206
Uniprot ID Q96N38

Related Products