shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(ZNF827-shRNA-Seq1)(CAT#: AdV-SI2286WQ)

This product is a ZNF827-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The ZNF827 gene encodes a protein that may be involved in transcriptional regulation. The expression of ZNF827-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert ZNF827-shRNA-Seq1
Related Target/Protein ZNF827
Region CDS
TargetSeq GAGTTTCTAAACCCTCCAATT
NCBI RefSeq NM_178835
Titer >1*10^10 GC/mL
Target Gene
Gene ID 152485
Uniprot ID Q17R98

Related Products