shRNA Lentivirus (self-inactivating), p7SK-(0610037P05Rik-shRNA-Seq1)(CAT#: LV-SI3993WQ)
This product is a 0610037P05Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 0610037P05Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | 0610037P05Rik-shRNA-Seq1 |
| Related Target/Protein | 0610037P05Rik |
| Region | CDS |
| TargetSeq | CAGTTTCTCATCCGTGAACTA |
| NCBI RefSeq | NM_025345 |
| Alternative Names | Fopnl |
| Titer | >1*10^10 GC/mL |
