shRNA Lentivirus (self-inactivating), p7SK-(BOD1-shRNA-Seq3)(CAT#: LV-SI1188WQ)
This product is a BOD1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The BOD1 gene is required for proper chromosome biorientation through the detection or correction of syntelic attachments in mitotic spindles. The expression of BOD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | BOD1-shRNA-Seq3 |
Related Target/Protein | BOD1 |
Region | 3UTR |
TargetSeq | CGAAACATGAAATCCTAGAAT |
NCBI RefSeq | NM_138369 |
Alternative Names | FAM44B |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |