shRNA Lentivirus (self-inactivating), p7SK-(BOD1-shRNA-Seq3)(CAT#: LV-SI1188WQ)
This product is a BOD1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The BOD1 gene is required for proper chromosome biorientation through the detection or correction of syntelic attachments in mitotic spindles. The expression of BOD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | BOD1-shRNA-Seq3 |
| Related Target/Protein | BOD1 |
| Region | 3UTR |
| TargetSeq | CGAAACATGAAATCCTAGAAT |
| NCBI RefSeq | NM_138369 |
| Alternative Names | FAM44B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |
