shRNA Lentivirus (self-inactivating), p7SK-(TXNDC5-shRNA-Seq1)(CAT#: LV-SI3316WQ)

This product is a TXNDC5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TXNDC5 gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The expression of TXNDC5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TXNDC5-shRNA-Seq1
Related Target/Protein TXNDC5
Region CDS
TargetSeq CGAAACTGTCAAGATTGGCAA
NCBI RefSeq NM_022085
Alternative Names HCC2; ERP46; HCC-2; STRF8; PDIA15; UNQ364; ENDOPDI
Titer >1*10^10 GC/mL
Related Diseases Disulfide-isomerase deficiency
Target Gene
Gene ID 81567
Uniprot ID Q8NBS9

Related Products