shRNA Lentivirus (self-inactivating), p7SK-(C12orf48-shRNA-Seq2)(CAT#: LV-SI1275WQ)
This product is a C12orf48-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C12orf48 is required to suppress inappropriate homologous recombination, thereby playing a central role DNA repair and in the maintenance of genomic stability. The expression of C12orf48-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C12orf48-shRNA-Seq2 |
Related Target/Protein | C12orf48 |
Region | CDS |
TargetSeq | GAGGGTGTAAATCCATCTGTT |
NCBI RefSeq | NM_017915 |
Alternative Names | AROM; PARI; PARPBP |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular Carcinoma |