shRNA Lentivirus (self-inactivating), pU6-(WBP2NL-shRNA-Seq1)(CAT#: LV-SI1905WQ)
This product is a WBP2NL-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by WBP2NL gene may promote meiotic resumption and pronuclear development during oocyte fertilization. The expression of WBP2NL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | WBP2NL-shRNA-Seq1 |
| Related Target/Protein | WBP2NL |
| Region | CDS |
| TargetSeq | CCCGAGGATTTCCACTTAGAA |
| NCBI RefSeq | NM_152613 |
| Alternative Names | PAWP; GRAMD7 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |
