shRNA Lentivirus (self-inactivating), p7SK-(C6orf141-shRNA-Seq3)(CAT#: LV-SI1312WQ)
This product is a C6orf141-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Low C6orf141 Expression is Significantly Associated with a Poor Prognosis in Patients with Oral Cancer. The expression of C6orf141-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C6orf141-shRNA-Seq3 |
| Related Target/Protein | C6orf141 |
| Region | CDS |
| TargetSeq | GAAAGTGCTCTTTCTCCTGCA |
| NCBI RefSeq | NM_153344 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oral Cancer |
