shRNA Lentivirus (self-inactivating), pH1-(1700029H14Rik-shRNA-Seq1)(CAT#: LV-SI3134WQ)

This product is a 1700029H14Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 1700029H14Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 1700029H14Rik-shRNA-Seq1
Related Target/Protein 1700029H14Rik
Region CDS
TargetSeq CTAGAGGACGACAGGAAGAAA
NCBI RefSeq NM_025601
Titer >1*10^10 GC/mL
Target Gene
Gene ID 66501
Uniprot ID G3X906

Related Products