shRNA Lentivirus (self-inactivating), p7SK-(CCDC67-shRNA-Seq3)(CAT#: LV-SI1198WQ)
This product is a CCDC67-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CCDC67 gene is key structural component of the deuterosome, a structure that promotes de novo centriole amplification in multiciliated cells. The expression of CCDC67-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CCDC67-shRNA-Seq3 |
Related Target/Protein | CCDC67 |
Region | CDS |
TargetSeq | GCAATGACTCAGAATTATGAA |
NCBI RefSeq | NM_181645 |
Alternative Names | DEUP1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Papillary thyroid carcinoma, gastric cancer |