shRNA Lentivirus (self-inactivating), p7SK-(Chst15-shRNA-Seq2)(CAT#: LV-SI3451WQ)
This product is a Chst15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Chst15 gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. The expression of Chst15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Chst15-shRNA-Seq2 |
Related Target/Protein | Chst15 |
Region | CDS |
TargetSeq | CTACTTCGCAAGTTCCAATAA |
NCBI RefSeq | NM_029935 |
Alternative Names | BRAG; GALNAC4S-6ST |
Titer | >1*10^10 GC/mL |
Related Diseases | Thrombus |