shRNA Lentivirus (self-inactivating), p7SK-(COQ9-shRNA-Seq1)(CAT#: LV-SI1121WQ)
This product is a COQ9-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The COQ9 gene encoded protein is likely necessary for biosynthesis of coenzyme Q10, as mutations at this locus have been associated with autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency. The expression of COQ9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | COQ9-shRNA-Seq1 |
Related Target/Protein | COQ9 |
Region | CDS |
TargetSeq | CAGTGGAAACCAGACTGAGAA |
NCBI RefSeq | NM_020312 |
Alternative Names | COQ10D5; C16orf49; HSPC326; PSEC0129 |
Titer | >1*10^10 GC/mL |
Related Diseases | Autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency |