shRNA Lentivirus (self-inactivating), p7SK-(Eif2b1-shRNA-Seq3)(CAT#: LV-SI3613WQ)

This product is a Eif2b1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Eif2b1 gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. The expression of Eif2b1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Eif2b1-shRNA-Seq3
Related Target/Protein Eif2b1
Region CDS
TargetSeq GCCTGATTTATCTGGTAAGAA
NCBI RefSeq NM_145371
Alternative Names EIF2B; EIF2BA
Titer >1*10^10 GC/mL
Related Diseases Leukoencephalopathy
Target Gene
Gene ID 1967
Uniprot ID Q14232

Related Products