shRNA Lentivirus (self-inactivating), pU6-(OR52E5-shRNA-Seq6)(CAT#: LV-SI1603WQ)

This product is a OR52E5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR52E5 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR52E5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR52E5-shRNA-Seq6
Related Target/Protein OR52E5
Region CDS
TargetSeq GCCTGCATCACACAGATGTAT
NCBI RefSeq XM_372369
Alternative Names OR11-56
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 390082
Uniprot ID Q8NH55

Related Products