shRNA Lentivirus (self-inactivating), p7SK-(Eif4h-shRNA-Seq5)(CAT#: LV-SI3632WQ)

This product is a Eif4h-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Eif4h gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. The expression of Eif4h-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Eif4h-shRNA-Seq5
Related Target/Protein Eif4h
Region CDS
TargetSeq CAGAGACAAAGACACAGACAA
NCBI RefSeq NM_033561
Alternative Names WSCR1; WBSCR1; eIF-4H
Titer >1*10^10 GC/mL
Related Diseases Williams syndrome
Target Gene
Gene ID 7458
Uniprot ID Q15056

Related Products